Microsatellites or simple sequence repeats (SSRs) are short (1–6 bp)
repeat motifs that can be found in both coding and non-coding DNA sequences of
all higher organisms examined to date (Liu et al. 2020; Manee et al. 2020). They are usually associated
with a high level of frequency of polymorphism, which provides a basis for the
development of a marker system. Thanks to the characters of high level of
polymorphism, co-dominant inheritance, adaptability to
high-throughput genotyping, SSR marker technique, have been broadly used in genetic diversity
analysis and linkage mapping (Röder et al. 1998; Liu et al.
2019).
Earlier experimental methods for developing SSRs
involved isolating and sequencing clones containing putative SSR tracts,
followed by designing and testing of flanking primers, which are laborious and
costly (Schloss et al. 2002). With the
development of next generation sequencing, obtaining high-throughput SSR
information in the transcribed gene region and development of expressed
sequence tag-SSR (EST-SSR) markers on large-scale is available. The EST-SSR
markers provide the possibility of direct tagging of gene of interest (Xiao et al. 2014; Nie et al. 2017). They are likely to be more conserved across
related species and therefore find higher levels of cross-species transferability than genomic SSRs (Cordeiro et al. 2001; Kantety et al. 2002; Decroocq et al. 2003), aiding in identification of conserved gene order across
orthologous linkage groups for comparative analysis (Varshney et al. 2005). Development of EST-SSRs for different
crops and ornamentals, such as oil palm (Xiao et al. 2014), tree peony (Wu et
al. 2014), Miscanthus (Nie et al. 2017), Tagetes erecta (Zhang et al. 2018), Hibiscus esculentus (Li et al. 2018) and glycyrrhiza (Liu et al. 2019), has been carried out.
Pansies (Viola
×wittrockiana) are among the most popular garden flowers around the world. However, their DNA markers resources available are very limited. So far, only four DNA
marker systems have been used in pansies, involving Random Amplified Polymorphic (RAPD) (Ko et al. 1998; Wang and Bao 2007; Vemmos 2015), Inter-Simple Sequence Repeat (ISSR) (Yockteng
et al. 2003; Culley et al. 2007), Sequence-related Amplified Polymorphism
(SRAP) (Wang et al.
2012; Du et al. 2019a) and Restriction Site Amplified Polymorphism (RSAP) (Li et al. 2015a). These DNA markers are usually dominant and unable to distinguish
heterozygous from dominant homozygous resulting in insufficient genetic information.
The co-dominant markers like EST-SSR for pansies are lacking.
Clausen
(1926) reported that pansies were the hybrids of Viola section Melanium, which originated from the crossing between a wild flower of Europe known as V. tricolor and a yellow Viola, V. lutea, and later further crossed with V. cornuta. But Zhang et al. (2010) believed that pansies were
originally derived from the crossing
between V. tricolor and V. lutea, and then the hybrid was
crossed with a large and varied flower colored perennial V. altaica. Analysis of the genetic relationship among V.×wittrockiana, V. tricolor and V. cornuta in molecular level by
utilizing DNA markers will be helpful to clarify this problem and the parent
selection in pansies crossbreeding programs.
In this paper, bases on a de novo RNA-sequencing of pansies
leaves at the transcriptome level (Du et
al. 2019b), we designed the EST-SSR primers according to the flanking
sequences of SSRs, then selected 70 primers to examine their efficiency of transferability and analysis ability on genetic diversity of
pansies employing 42 pansies accessions and their related species. The objectives of this study were (i) to develop some
EST-SSR markers for pansies, (ii) to examine the efficiency of marker
transferability within viola, and
(iii) to evaluate these EST-SSR markers in the genetic relationship analysis in
pansies.
Materials and Methods
Plant material and DNA isolation
A total of 40 accessions of Viola section Melanium including 35
breeding lines of V. ×wittrockiana, 3 breeding lines of V. cornuta and 2 lines of V. tricolor, and 2 wild species involving V. hancockii and V. prionantha of section Viola in Xinxiang, Henan province, China, were employed in this
study (Table 1). All accessions were grown at the field site of Henan Institute of
Science and Technology.
Genomic DNA was extracted from 0.2
g fresh leaves using SDS method. The quality of DNA was checked on a 0.6% (w/v)
agarose gel and the concentration was determined by UV visible (Thermo
Scientific NanoDrop2000, USA). All DNA samples were diluted to 20 ng L-1
and stored at -20°C prior to PCR amplification.
Generation
of EST-SSRs and designing of primers
Using MISA software, a total of 23,791 potential SSRs were identified from 20, 679 unigene
sequences after transcriptome sequencing of the pansies leaves. PRIMER3
(http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) was employed to
design EST-SSR primers with the following criteria: 18–23 bp primer length,
55–65°C melting temperature, 40–60% GC content, and 80–300 bp amplicon size.
Finally, a total of 6,863 specific primer pairs were designed from 9,228 SSR-containing sequences. To test these primers
availability, 70 primer pairs were selected for synthesis and screened in the
experimental plant materials.
Amplification
and detection of microsatellite alleles
PCR amplification was performed in a total volume of 10 μL containing 2 μL (40
ng) genomic DNA, 2 μL ddH2O, 5 μL 1 × Taq PCR Master Mix
(Beijing ComWin Biotech Co. Ltd., Beijing, China),
and 0.5 μL (10 pmol)
each reverse and forward primer. The following amplification protocol was
performed: pre-denaturation at 95°C for 2 min, followed by 35 cycles of
denaturation at 95°C for 30 s, annealing at 58–60°C for 30 s (different primer
annealing temperatures are shown in Table 2) and extension at 72°C for 30 s,
with a final extension at 72°C for 4 min. The PCR products were separated on 6%
(w/v) denaturing polyacrylamide gels in 1×TBE buffer solution at 60 w of power
for 2.5 h, and then stained using silver staining protocol. The separated DNA
bands were visualized and estimated by comparing with 100 bp
ladder molecular size standard (Solarbio).
Data analysis
The number of effective alleles (Ne), Shannon’s
information index (I), observed heterozygosity (HO), expected
heterozygosity (HE), percentage of polymorphic alleles (PPA), and
genetic differentiation coefficient (FST),
gene flow (Nm), and Nei’s gene diversity (H), genetic distances among different
populations, were calculated using Popgene 32 (Quardokus 2000). A principal
coordinate analysis (PCoA) based on simple matching similarity coefficients and
unweighted pair group method arithmetic averages (UPGMA) were used to cluster all accessions using NTSYSpc 2.1 (Jensen 1989). Analysis of molecular variance between and within of section Melanium and section Viola was
calculated using GeneAlEx v6.501 (Peakall
and Smouse 2006; 2012).
Results
SSR
marker development
Seventy EST-SSR primer pairs were tested on 42 pansies accessions involving
4 related species. Forty-nine primer pairs (70%)
successfully amplified DNA for V.×wittrockiana, V. tricolor and V. cornuta. Of these, 40 primer pairs generated amplicons for two species of section Viola, and 36 primer pairs produced amplicons for all of the species tested. This suggested that most of
EST-SSR markers developed from V.×wittrockiana can be transferable across species both in section Melanium and section Viola. The
characterizations of these primer pairs and their amplicons sizes are presented in Table 2.
Table 1: The name, pedigree, species, flower type, and origin of
the Viola accessions in this study
No. |
Name |
Pedigrees |
Flower type |
Species |
Country/Company
of origin |
1 |
DFM-11-1-1 |
Frühblühende Mischung |
large |
V. ×wittrockiana |
Germany/Gartenland Aschersleben |
2 |
DFM-11-2-3 |
Frühblühende Mischung |
large |
V. ×wittrockiana |
Germany/Gartenland Aschersleben |
3 |
DFM-11-2-4-1 |
Frühblühende Mischung |
large |
V. ×wittrockiana |
Germany/Gartenland Aschersleben |
4 |
DFM-1-2-3-3 |
Frühblühende Mischung |
large |
V. ×wittrockiana |
Germany/Gartenland Aschersleben |
5 |
DFM-16-1-2-6 |
Frühblühende Mischung |
large |
V. ×wittrockiana |
Germany/Gartenland Aschersleben |
6 |
DFM-16-2-2 |
Frühblühende Mischung |
large |
V. ×wittrockiana |
Germany/Gartenland Aschersleben |
7 |
DFM-8-3-1-2 |
Frühblühende Mischung |
large |
V. ×wittrockiana |
Germany/Gartenland Aschersleben |
8 |
DSRAB-1-2-3 |
Schweizer Riesen Alpensee |
large |
V. ×wittrockiana |
Germany/Dehner Seed |
9 |
DSRAB-1-2-4 |
Schweizer Riesen Alpensee |
large |
V. ×wittrockiana |
Germany/Dehner Seed |
10 |
DSRAB-1-4-2 |
Schweizer Riesen Alpensee |
large |
V. ×wittrockiana |
Germany/Dehner Seed |
11 |
DSRFY-1-1-2 |
Schweizer Riesen Firnengold |
large |
V. ×wittrockiana |
Germany/Dehner Seed |
12 |
G10-1-1-1-3-3 |
229.10 |
medium |
V. ×wittrockiana |
China/JiuQuan Jinqiu Horticulture
Seed |
13 |
G10-1-3-1-2 |
229.10 |
medium |
V. ×wittrockiana |
China/JiuQuan Jinqiu Horticulture
Seed |
14 |
G10-1-3-1-4-2 |
229.10 |
medium |
V. ×wittrockiana |
China/JiuQuan Jinqiu Horticulture
Seed |
15 |
G1-1-1-1-1-4 |
229.01 |
medium |
V. ×wittrockiana |
China/JiuQuan Jinqiu Horticulture
Seed |
16 |
G10-1-1-1-3-2 |
229.10 |
medium |
V. ×wittrockiana |
China/JiuQuan Jinqiu Horticulture
Seed |
17 |
HAR2-1-14-1-1 |
Aalsmeerse Giants |
large |
V. ×wittrockiana |
NL/Buzzy Seeds |
18 |
JB-1-1-1 |
Penny Blue |
small |
V. cornuta |
USA/Goldsmith
seed |
19 |
JB-1-1-6 |
Penny Blue |
small |
V. cornuta |
USA/Goldsmith
seed |
20 |
JY-1-1-2 |
Penny Yellow |
small |
V. cornuta |
USA/Goldsmith
seed |
21 |
MYB-1-2 |
MatrixTM Yellow Blotch |
large |
V. ×wittrockiana |
USA/PanAmerican Seed |
22 |
MYC-1-1-3-4 |
MatrixTM Yellow Clear |
large |
V. ×wittrockiana |
USA/PanAmerican Seed |
23 |
PXP-BT-4-1-1-1 |
Panola XP Blue True |
medium |
V. ×wittrockiana |
USA/PanAmerican Seed |
24 |
PXP-BT-4-1-1 |
Panola XP Blue
True |
medium |
V. ×wittrockiana |
USA/PanAmerican Seed |
25 |
RCO-1-3-4 |
Clear orange of
power mini |
medium |
V. ×wittrockiana |
Japan/Takii Seed |
26 |
RRB-1-3 |
Beacon blue of
Dynamite |
large |
V. ×wittrockiana |
Japan/Sakata
Seed |
27 |
RRB-2-7 |
Beacon blue of
Dynamite |
large |
V. ×wittrockiana |
Japan/Sakata
Seed |
28 |
RRB-3-1 |
Beacon blue of
Dynamite |
large |
V. ×wittrockiana |
Japan/Sakata
Seed |
29 |
XXL-G-1-1-2-3 |
XXL Golden e |
extra large |
V. ×wittrockiana |
USA/PanAmerican Seed |
30 |
XXL-G-1-1-3 |
XXL Golden |
extra large |
V. ×wittrockiana |
USA/PanAmerican Seed |
31 |
XXL-G-1-1-7-4 |
XXL Golden |
extra large |
V. ×wittrockiana |
USA/PanAmerican Seed |
32 |
EYO-1-2-1-4 |
Yellow large
flower |
large |
V. ×wittrockiana |
China/Shanghai
Academy of Landscape Architecture Science and Planning |
33 |
EYO-1-2-1-5 |
Yellow large
flower |
large |
V. ×wittrockiana |
China/Shanghai
Academy of Landscape Architecture Science and Planning |
34 |
EYO-1-1-4 |
Yellow large
flower |
large |
V. ×wittrockiana |
China/Shanghai
Academy of Landscape Architecture Science and Planning |
35 |
EWO-2-1-1 |
White large
flower |
medium |
V. ×wittrockiana |
China/Shanghai
Academy of Landscape Architecture Science and Planning |
36 |
EWO-1-1-3 |
White large
flower |
medium |
V. ×wittrockiana |
China/Shanghai
Academy of Landscape Architecture Science and Planning |
37 |
MW-1-1-1-1 |
Light blue
flower |
medium |
V. ×wittrockiana |
China/Henan
Institute of Science and Technology |
38 |
EWO-MW |
Light blue
flower |
medium |
V. ×wittrockiana |
China/Henan
Institute of Science and Technology |
39 |
E01 |
Blue-purple
small flower |
small |
V. tricolor |
China/Shanghai
Academy of Landscape Architecture Science and Planning |
40 |
08H |
small |
V. tricolor |
Germany/Dehner Seed |
|
41 |
V. hancockii |
Wild species |
small |
V. hancockii |
China/Xinxiang |
42 |
V. prionantha |
Wild species |
small |
V. prionantha |
China/Xinxiang |
Fig. 1: The profile of amplification by EST-SSR primer pair P66
A total of 309 amplicons were
produced by these primer pairs, with average of 6.3 amplicons per primer pair.
The most amplicon-producing primer pair was P66, which produced 18 amplicons
(Fig. 1). Nineteen EST-SSR primer pairs (39%) amplified a single amplicons and
30 primer pairs (61%) amplified two to five loci, resulting in 96 loci in total
(Table 3). The number of alleles per locus ranged from 1 to 13, with an average
of 3.22 alleles per locus. Approximately 61% of the primer pairs amplified at
least one PCR fragment size larger than expected. For example, the expected
product size for primer P66 was 151 bp, but one of
PCR amplicons was more than 400 bp.
Genetic diversity
Table 2: Characterization of
49 EST-SSR markers
Primer ID. |
Forward primer sequence (5′→3′) |
Reverse primer sequence (5′→3′) |
Tm (oC) |
Expected product size (bp) |
Amplified product size (bp) |
Motif |
Corresponding unigene function |
No. of Loci |
P1 |
ACCTGAGCCTGATTCCAAGC
|
CCATCTCCGGTCACTGTTCC |
60 |
203 |
260-480 |
(CTG)5 |
Uncharacterized
protein |
2 |
P2 |
AGGTCTGCGAGGAGGAAGAT
|
TGTATCCCATTGACCGCCAG |
60 |
168 |
160-200 |
(GCG)5 |
hypothetical
protein POPTR |
2 |
P3 |
GCCTTGTCCTCAGCAAAACG
|
TGCAAGAGCTTTTCGTCAGC |
60 |
219 |
210-500 |
(TCG)5 |
conserved
hypothetical protein |
3 |
P5 |
CCCAAACCTTAACCCGAGCT |
GATACGGTTGGAGTGGACGG |
60 |
224 |
165-300 |
(CAC)5 |
uncharacterized
protein |
3 |
P9 |
CCCCCGCAATTTTGGTGAAG
|
CTGGGCATGGTTGATCAGGT |
60 |
108 |
100-200 |
(TGA)6 |
formin homology 2 domain-containing family protein |
2 |
P11 |
TCCTCAACCTCCTGCTCAGA |
CCACTACCCAACAAACCCCA |
60 |
238 |
160-170 |
(TC)6 |
hypothetical
protein POPTR |
1 |
P12 |
GAGGGCTCGTTTCAAATGGC
|
GCAAATGGGTCGTCGTCAAC |
60 |
185 |
180-410 |
(CAG)5 |
transcription
factor bHLH63 isoform X1 |
5 |
P16 |
CGCAGTCTCCGTCGATTACA |
TGTCTCCGGCTAAAACCACC |
60 |
170 |
160-340 |
(CCG)5 |
catalytic |
4 |
P17 |
TCTCTCCCTCACTTCTCCGT
|
GCTTGGCTCTGACGTAAGGT |
60 |
175 |
165-280 |
(GCA)5 |
Tetratricopeptide repeat-like
superfamily protein |
1 |
P18 |
TTTCCACCTCCAAACCTCGG
|
TGTTTGATGCTGCAGGGGTA |
60 |
289 |
250-360 |
(CCA)5 |
pumilio homolog 1-like |
2 |
P20 |
GAGCTGGAGATCCCGTTAGC
|
CCTCTGCTTCTGCTAACCCC |
59 |
278 |
290-340 |
(GCT)5 |
VQ
motif-containing family protein |
2 |
P21 |
AAGGTGGCTCAGTGCATCTC
|
GCAGTGAAGGAAACACACGC |
60 |
229 |
190-300 |
(CTC)5 |
RNA-binding
protein |
3 |
P23 |
TGCCACCTGATTCCATTGCA
|
TGTGGCTGTTTGTTGTGCTG |
60 |
203 |
200-300 |
(AGG)5 |
transcription
factor bHLH91-like |
3 |
P24 |
GGTAGGAGACGCTGGGAAAC
|
GCCGCGTTACCATAGCTAGT |
60 |
288 |
220-420 |
(AGC)5 |
B3
domain-containing transcription factor NGA1-like isoform X1 |
3 |
P25 |
GGGAAGAGTGAACGAGGTGG
|
GGCATCTTGTTGCTGCTTCC |
60 |
271 |
150-185 |
(TAC)6 |
transcription
factor GTE6 |
1 |
P26 |
CCGCCTACTCCACTGAACTC
|
ACATGGAAGAGGAGCAAGCA |
59 |
265 |
100-150 |
(TCA)5 |
small RNA
2'-O-methyltransferase-like |
2 |
P27 |
GCTTATGTGCAGTGTATGGCG
|
ACCTCTTTCTGCACACCACC |
60 |
137 |
110-150 |
(GCT)8 |
aha1
domain-containing family protein |
2 |
P30 |
ACCGCAAACCAAGCAAACAA |
TGAGGATGAAGGGGATGGGA |
60 |
169 |
110-220 |
(CAT)6 |
hypothetical
protein POPTR |
2 |
P32 |
GAAACTATCCACCACCGCCA |
TCGGGAATACGGTGGTTGTG |
60 |
167 |
167-210 |
(CCA)5 |
carboxypeptidase Y |
2 |
P33 |
ACCTCCCCCTCTTCCTCATC
|
TTTCAGCCGATCGACGTAGG |
60 |
253 |
200-270 |
(CCG)5 |
hypothetical
protein POPTR |
1 |
P34 |
GGACCTGCTGCCTCATCAAG |
CCAGGTCACAATTCCAACTGC |
60 |
111 |
300-340 |
(AAG)5 |
mitochondrial
import receptor TOM20-2 family protein |
2 |
P35 |
CCATTCGCTACAGCTTTGGC
|
CGGAGGAGGTTGTTTTGGGT |
60 |
223 |
170-190 |
(CCA)5 |
protein OSB3 |
1 |
P36 |
CTCACTGAGTGGCTCATCCC
|
GAGGGGACATTGAGGCTGAC |
60 |
128 |
128 |
(TCT)5 |
PWWP
domain-containing family protein |
1 |
P38 |
CGAAGAGCTTGAAGGCCCAA
|
TGATGCTGCCGAAACTAACG |
59 |
239 |
170-240 |
(CAA)5 |
7-deoxyloganetic
acid glucosyltransferase-like |
2 |
P39 |
CCCCTCCCACCTTTCCTTTC |
CAGGCTGTTTGGTTGCTGAC |
60 |
141 |
150-230 |
(GGC)5 |
uncharacterized
protein |
2 |
P40 |
AGGCTCCTAGGGTCAAACCT
|
CGTCGCAAACAGTGAACACA |
60 |
250 |
350-570 |
(GTG)5 |
Small nuclear ribonucleoprotein |
1 |
P41 |
AGAACAGCAGCCCCTTTTGG
|
GGCCAGCCCCATTTTCATTG |
60 |
196 |
190-210 |
(TGA)5 |
aluminum-activated
malate transporter 9-like |
1 |
P42 |
TGGCACTCTTCCTCGTTGTC
|
TGTCGTAGAGGCTGCCTACT |
60 |
138 |
120-190 |
(CTC)5 |
cytochrome P450
98A2 |
1 |
P43 |
TTCAAAGCCATCCACCTCCC
|
AGCAGTGGAGAGGGGATCAT |
60 |
255 |
200-240 |
(CT)6 |
nuclear acid
binding protein |
1 |
P44 |
AGCCAAGCCTCTCTCTCGTA
|
AGCAGTGGAGAGGGGATCAT |
60 |
194 |
200-210 |
(AGC)5 |
nuclear acid
binding protein |
1 |
P45 |
CCTGGTGCGGAATTGTTGTG |
GGGAGCTGGGTTTGTTGAGT |
60 |
265 |
200-350 |
(CAC)5 |
uncharacterized
protein LOC105644223 isoform X1 |
2 |
P46 |
AGGGTTGAGCCTCAGTCTCT
|
ACGCAATGAAACATGCCCTG |
60 |
224 |
200-520 |
(AGG)5 |
uncharacterized
PKHD-type hydroxylase At1g22950-like isoform X1 |
3 |
P47 |
GGCGATCGAGAAATGAGGCT
|
CGCTACCCATCATCTGTCTCC |
60 |
286 |
260-370 |
(TGC)5 |
lipoxygenase |
3 |
P48 |
ACGGTGGTGGTTTATGGTGG
|
CTCTGGTGGTTCGAGTGGTC |
60 |
273 |
200-500 |
(TTC)6 |
hypothetical
protein POPT |
2 |
P49 |
GTGGCAAAGCTGGGAACAAG
|
TGCTACTACCCGTTTTGCTCT |
59 |
149 |
180-240 |
(CAG)5 |
hypothetical
protein |
1 |
P50 |
TGTCAACGGAGCAAAA
TGGTC |
GCCTGTGGAAAAAGCAAGCA |
59 |
196 |
190-255 |
(ACT)6 |
transcriptional corepressor LEUNIG-like isoform X |
1 |
P51 |
GATCCCACAGCGTTTACCCA
|
GCCGCGTTACCATAGCTAGT |
60 |
224 |
200-360 |
(AGC)5 |
B3
domain-containing transcription factor NGA1-like isoform X1 |
4 |
P52 |
ATTGCTACAGTCGCCATCCC
|
GAGCGGACCGGATGTGTTTA |
60 |
196 |
180-190 |
(TC)6 |
amino acid
transporter |
1 |
P53 |
AGGCTTCCTCTTCGGTCTCT
|
GTCTGGATCCCGACGAATCC |
60 |
171 |
170-230 |
(CTC)5 |
probable beta-1,3-galactosyl transferase 14 |
1 |
P57 |
TGTGACGACTGAAAAGGCCA
|
GCACAAACAACATAAGGGCGA |
60 |
267 |
420-460 |
(GAA)5 |
phenylalanyl-tRNA synthetase beta chain |
1 |
P58 |
TTAGGACGAGCATGCACAGG
|
CGCAGTTCGTTTCACCGATG |
60 |
279 |
220-450 |
(ATC)5 |
NADH
dehydrogenase |
2 |
P61 |
TCAGCTCAGCGAGAAACACA
|
AGGAAAGACACCACCACCAC |
60 |
234 |
235-340 |
(CTG)5 |
Jatropha curcas protein tesmin/TSO1-like CXC 5 |
1 |
P62 |
TCACCGACCAGCAAACATCA
|
GGGGTTTTGTGGAAAGGTGC |
60 |
198 |
190-200 |
(CTT)5 |
protein FD-like
isoform X2 |
1 |
P63 |
ATGGGGAAATGGCCTCACAA
|
TCCCAAATGGCATCGGAACT |
60 |
247 |
250-305 |
(AC)9 |
bidirectional
sugar transporter SWEET2 |
2 |
P65 |
GGCCGTATGTCTTCCACACA
|
CAGGGGTGGGCAAAGATCAT |
60 |
244 |
230-310 |
(ATC)5 |
casein kinase
I-like |
2 |
P66 |
CCTTCCGCTTACTCACTCCG
|
TGTACGGATGCGAATCGAGG |
60 |
151 |
150-460 |
(AAG)5 |
Uncharacterized
protein isoform 1 |
3 |
P67 |
TACCCAGAAAACTCCACCGC
|
ATCCGCCCAGTTTGTAGTGG |
60 |
280 |
280 |
(AGA)5 |
probable AMP deaminase |
1 |
P68 |
AAACCCCAAAAACCGCATGG
|
AAATCCCCTCCCTCTCCTCC |
60 |
144 |
144-280 |
(GT)6 |
hypothetical
protein CISIN |
4 |
P70 |
TTTGTCGACGCCATCATCCA
|
GGGCGTATGCAGGACATGAT |
60 |
276 |
276-610 |
(TGA)5 |
mitotic spindle
checkpoint family protein |
2 |
In total: |
|
|
|
|
|
96 |
When the amplicons amplified were screened for length polymorphisms, 283
polymorphic alleles generated by 46 primer pairs were detected among 42
genotypes, with an average of 6.15 polymorphic alleles per primer pair. A total of 269 polymorphic alleles were produced for section Melanium by 46 primer pairs. Of these, 266 polymorphic alleles were for V.×wittrockiana, 84 polymorphic alleles for V. cornuta, and 50 polymorphic alleles for V. tricolor. The number of polymorphic alleles for Viola section was 44. The most polymorphic alleles were generated
by primer P66, yielding 17 polymorphic alleles. However, three primer pairs
including P36, P52 and P67 produced no polymorphic alleles.
Table 3: Genetic diversity of locus level
estimated from 42 accessions of Viola
Locus |
N |
Ne |
I |
He |
Ho |
FST |
Nm |
H |
V1185 |
1 |
1.707 |
0.605 |
0.414 |
0.419 |
0.100 |
4.482 |
0.418 |
V1200 |
1 |
1.049 |
0.114 |
0.047 |
0.048 |
0.022 |
22.328 |
0.047 |
V2300 |
2 |
1.445 |
0.483 |
0.306 |
0.310 |
0.321 |
1.683 |
0.282 |
V2330 |
3 |
1.505 |
0.466 |
0.302 |
0.305 |
0.566 |
0.417 |
0.316 |
V3180 |
2 |
1.849 |
0.650 |
0.458 |
0.464 |
0.767 |
0.152 |
0.437 |
V3220 |
4 |
1.655 |
0.573 |
0.387 |
0.392 |
0.417 |
1.125 |
0.389 |
V5170 |
4 |
1.320 |
0.318 |
0.195 |
0.198 |
0.433 |
6.338 |
0.201 |
V5230 |
4 |
1.485 |
0.473 |
0.307 |
0.311 |
0.238 |
3.999 |
0.312 |
V5270 |
3 |
1.194 |
0.289 |
0.157 |
0.159 |
0.083 |
6.877 |
0.159 |
V9190 |
2 |
1.062 |
0.135 |
0.059 |
0.059 |
0.114 |
12.133 |
0.060 |
V9220 |
2 |
1.337 |
0.384 |
0.234 |
0.237 |
0.554 |
1.304 |
0.256 |
V1123 |
2 |
1.986 |
0.690 |
0.497 |
0.503 |
0.192 |
5.600 |
0.493 |
V1218 |
2 |
1.354 |
0.410 |
0.250 |
0.253 |
0.541 |
2.824 |
0.126 |
V1222 |
4 |
1.359 |
0.426 |
0.259 |
0.263 |
0.259 |
2.640 |
0.269 |
V1226 |
3 |
1.611 |
0.534 |
0.358 |
0.362 |
0.377 |
1.245 |
0.368 |
V1231 |
4 |
1.707 |
0.598 |
0.409 |
0.414 |
0.289 |
5.252 |
0.416 |
V1241 |
2 |
1.725 |
0.609 |
0.418 |
0.424 |
0.550 |
0.410 |
0.443 |
V1617 |
4 |
1.230 |
0.271 |
0.162 |
0.164 |
0.530 |
0.874 |
0.053 |
V1621 |
4 |
1.548 |
0.464 |
0.310 |
0.314 |
0.499 |
5.802 |
0.321 |
V1627 |
4 |
1.492 |
0.448 |
0.293 |
0.296 |
0.400 |
1.865 |
0.283 |
V1632 |
4 |
1.449 |
0.468 |
0.297 |
0.301 |
0.238 |
3.229 |
0.304 |
V1727 |
2 |
1.698 |
0.581 |
0.396 |
0.401 |
0.612 |
0.420 |
0.403 |
V1732 |
4 |
1.349 |
0.364 |
0.227 |
0.230 |
0.123 |
19.811 |
0.231 |
V1736 |
3 |
1.392 |
0.453 |
0.280 |
0.284 |
0.310 |
2.929 |
0.305 |
V1827 |
3 |
1.451 |
0.394 |
0.259 |
0.263 |
0.153 |
16.675 |
0.254 |
V1835 |
4 |
1.226 |
0.297 |
0.170 |
0.172 |
0.663 |
2.148 |
0.200 |
V2032 |
3 |
1.439 |
0.409 |
0.269 |
0.273 |
0.497 |
1.161 |
0.285 |
V2120 |
4 |
1.250 |
0.327 |
0.188 |
0.190 |
0.492 |
2.924 |
0.137 |
V2128 |
3 |
1.628 |
0.523 |
0.353 |
0.357 |
0.546 |
0.571 |
0.362 |
V2133 |
3 |
1.552 |
0.513 |
0.336 |
0.340 |
0.488 |
1.272 |
0.350 |
V2135 |
4 |
1.192 |
0.245 |
0.142 |
0.143 |
0.505 |
0.885 |
0.158 |
V2324 |
3 |
1.551 |
0.504 |
0.330 |
0.334 |
0.436 |
1.166 |
0.343 |
V2330 |
2 |
1.801 |
0.628 |
0.438 |
0.443 |
0.792 |
0.133 |
0.456 |
V2426 |
2 |
1.239 |
0.335 |
0.190 |
0.192 |
0.081 |
5.798 |
0.191 |
V2431 |
4 |
1.726 |
0.596 |
0.409 |
0.414 |
0.468 |
1.262 |
0.419 |
V2438 |
5 |
1.482 |
0.483 |
0.310 |
0.314 |
0.374 |
1.855 |
0.311 |
V2545 |
3 |
1.331 |
0.414 |
0.248 |
0.251 |
0.402 |
2.195 |
0.269 |
V2621 |
3 |
1.928 |
0.673 |
0.480 |
0.486 |
0.464 |
0.627 |
0.484 |
V2624 |
4 |
1.478 |
0.391 |
0.261 |
0.264 |
0.298 |
11.395 |
0.256 |
V2712 |
3 |
1.662 |
0.550 |
0.373 |
0.377 |
0.499 |
1.313 |
0.381 |
V2714 |
3 |
1.373 |
0.322 |
0.206 |
0.209 |
0.199 |
12.432 |
0.204 |
V3012 |
2 |
1.724 |
0.595 |
0.408 |
0.413 |
0.482 |
0.928 |
0.404 |
V3018 |
6 |
1.492 |
0.492 |
0.319 |
0.323 |
0.509 |
1.963 |
0.290 |
V3227 |
3 |
1.568 |
0.538 |
0.355 |
0.359 |
0.238 |
2.020 |
0.355 |
V3240 |
5 |
1.379 |
0.377 |
0.238 |
0.240 |
0.237 |
8.068 |
0.247 |
V3321 |
6 |
1.496 |
0.443 |
0.290 |
0.294 |
0.372 |
666.560 |
0.293 |
V3417 |
2 |
1.655 |
0.581 |
0.393 |
0.398 |
0.645 |
0.610 |
0.255 |
V3419 |
3 |
1.900 |
0.666 |
0.473 |
0.479 |
0.663 |
0.278 |
0.483 |
V3518 |
3 |
1.580 |
0.546 |
0.362 |
0.367 |
2.477 |
-0.250 |
0.360 |
V3822 |
2 |
1.600 |
0.509 |
0.339 |
0.343 |
0.256 |
2.676 |
0.334 |
V3830 |
4 |
1.726 |
0.603 |
0.414 |
0.419 |
0.343 |
2.381 |
0.408 |
V3845 |
3 |
1.819 |
0.632 |
0.442 |
0.447 |
0.222 |
2.668 |
0.444 |
V3911 |
3 |
1.706 |
0.594 |
0.406 |
0.411 |
0.666 |
0.384 |
0.327 |
V3919 |
3 |
1.389 |
0.375 |
0.236 |
0.239 |
0.223 |
6.521 |
0.228 |
V4050 |
3 |
1.339 |
0.372 |
0.227 |
0.230 |
0.571 |
2.175 |
0.231 |
V4120 |
3 |
1.761 |
0.596 |
0.412 |
0.419 |
-0.018 |
1333.196 |
0.405 |
V4219 |
2 |
1.995 |
0.692 |
0.499 |
0.506 |
0.732 |
0.183 |
0.490 |
V4324 |
2 |
1.494 |
0.377 |
0.258 |
0.261 |
0.381 |
1.031 |
0.253 |
V4421 |
1 |
1.084 |
0.169 |
0.077 |
0.078 |
1.244 |
-0.098 |
0.078 |
V4520 |
2 |
1.925 |
0.673 |
0.480 |
0.486 |
0.570 |
0.457 |
0.489 |
V4531 |
3 |
1.431 |
0.403 |
0.257 |
0.260 |
0.360 |
2.374 |
0.248 |
V4624 |
4 |
1.843 |
0.635 |
0.446 |
0.451 |
0.338 |
1.229 |
0.449 |
V4645 |
4 |
1.665 |
0.529 |
0.363 |
0.367 |
0.424 |
3.958 |
0.371 |
V4722 |
8 |
1.412 |
0.438 |
0.275 |
0.278 |
0.289 |
3.999 |
0.242 |
V4822 |
2 |
1.940 |
0.677 |
0.484 |
0.491 |
0.507 |
0.731 |
0.493 |
1 |
2.000 |
0.693 |
0.500 |
0.507 |
0.206 |
1.932 |
0.500 |
|
V4918 |
1 |
1.888 |
0.663 |
0.470 |
0.477 |
2.732 |
-0.317 |
0.462 |
V5025 |
2 |
1.466 |
0.498 |
0.318 |
0.322 |
-1.552 |
2000.000 |
0.323 |
V5120 |
2 |
1.626 |
0.561 |
0.376 |
0.381 |
0.394 |
0.955 |
0.385 |
V5124 |
2 |
1.490 |
0.510 |
0.328 |
0.332 |
0.342 |
1.308 |
0.305 |
V5128 |
4 |
1.447 |
0.439 |
0.283 |
0.286 |
0.264 |
2.317 |
0.274 |
V5322 |
5 |
1.748 |
0.594 |
0.409 |
0.414 |
0.327 |
2.228 |
0.407 |
V5727 |
5 |
1.350 |
0.355 |
0.222 |
0.225 |
0.431 |
5.670 |
0.216 |
V5825 |
4 |
1.523 |
0.506 |
0.329 |
0.333 |
-0.199 |
999.869 |
0.330 |
V5835 |
4 |
1.696 |
0.568 |
0.388 |
0.393 |
2.984 |
1499.882 |
0.392 |
V6129 |
5 |
1.421 |
0.357 |
0.232 |
0.235 |
0.318 |
9.420 |
0.238 |
V6219 |
1 |
1.159 |
0.264 |
0.137 |
0.139 |
0.111 |
4.019 |
0.141 |
V6326 |
3 |
1.732 |
0.611 |
0.421 |
0.426 |
0.293 |
1.694 |
0.429 |
V6329 |
2 |
1.409 |
0.466 |
0.290 |
0.294 |
0.481 |
1.526 |
0.306 |
V6530 |
3 |
1.316 |
0.336 |
0.204 |
0.207 |
0.278 |
1.604 |
0.198 |
V6616 |
3 |
1.568 |
0.453 |
0.311 |
0.315 |
0.222 |
15.931 |
0.299 |
V6618 |
1 |
1.049 |
0.114 |
0.047 |
0.048 |
0.022 |
22.328 |
0.047 |
V6634 |
13 |
1.400 |
0.353 |
0.227 |
0.230 |
0.252 |
3.595 |
0.224 |
V6816 |
2 |
1.478 |
0.438 |
0.284 |
0.287 |
0.312 |
1.441 |
0.275 |
V6821 |
2 |
1.284 |
0.319 |
0.194 |
0.196 |
0.106 |
12.225 |
0.183 |
V6827 |
6 |
1.485 |
0.404 |
0.268 |
0.271 |
0.264 |
8.098 |
0.263 |
V7035 |
3 |
1.145 |
0.229 |
0.121 |
0.123 |
0.226 |
16.793 |
0.134 |
V7060 |
4 |
1.584 |
0.511 |
0.343 |
0.347 |
0.314 |
3.341 |
0.337 |
Total |
283 |
1.523 |
0.468 |
0.308 |
0.312 |
0.440 |
0.637 |
0.304 |
N = Number of polymorphic alleles per locus; Ne = Effective number of alleles; I = Shannon’s Information index; HO = Observed heterozygosity;
HE = Expected heterozygosity; FST
= Genetic differentiation coefficient; Nm
= Gene flow; H = Gene diversity
Table 4: Genetic diversity parameters of Viola sections and species
Section |
Species |
NL |
N |
PPA (%) |
Na |
Ne |
I |
H |
Melanium |
|
40 |
269 |
94.70 |
1.922 |
1.495 |
0.444 |
0.296 |
|
Viola ×wittrockiana |
35 |
266 |
93.99 |
1.940 |
1.496 |
0.444 |
0.293 |
|
V. cornuta |
3 |
97 |
34.28 |
1.343 |
1.232 |
0.197 |
0.133 |
|
V. tricolor |
2 |
50 |
17.67 |
1.177 |
1.125 |
0.107 |
0.073 |
Viola |
|
2 |
48 |
16.96 |
1.186 |
1.132 |
0.1125 |
0.077 |
Total |
|
42 |
283 |
100.00 |
2.000 |
1.506 |
0.456 |
0.300 |
Note: NL = Number of
breeding lines; N = Number of
polymorphic alleles; PPA = Percentage
of polymorphic alleles; Na = Observed number of alleles; Ne =
Effective number of alleles, I=
Shannon's Information index; H = Nei's gene diversity
At the locus level, a total of 283 polymorphic alleles were present in 88
loci. The polymorphism level of the loci (I)
ranged from 0.114 (at the locus V6618) to 0.693 (V4850), with an average of 0.468. The mean observed
homozygosity (Ho) was 0.312, ranging
from 0.048 (at the locus V6618) to 0.507 (V4850), and the expected heterozygosity (He)
ranged from 0.047 (at the locus V6618) to 0.500 (V4850), with an average of 0.308 (Table 3). With
respect to the population level, the genetic diversity (H) ranged from 0.073 for V.
tricolor to 0.415 for V.×wittrockiana (Table 4).
Genetic relationship
Table 5: Genetic distances among Viola section or species tested
Population ID |
V. ×wittrockiana |
V. cornuta |
V. tricolor |
Viola section |
Viola ×wittrockiana |
|
0.9172 |
0.8357 |
0.7755 |
V. cornuta |
0.0865 |
|
0.8023 |
0.7381 |
V. tricolor |
0.1795 |
0.2202 |
|
0.6622 |
Viola section |
0.2542 |
0.3037 |
0.4122 |
|
Nei's genetic identity
(above diagonal) and genetic distance (below diagonal)
Table 6: Analyses of molecular variance (AMOVAs) for two Viola sections and three species of section Melanium
Source |
df |
Sum of squares |
Variance components |
Percentage of
variation |
P-value |
1. Total |
41 |
2029.143 |
72.171 |
100% |
|
Among sections |
1 |
142.418 |
25.003 |
35% |
0.005** |
Within sections |
40 |
1886.725 |
47.168 |
65% |
|
2. Melanium section |
39 |
|
|
|
|
Among species |
2 |
140.001 |
5.258 |
10% |
0.002** |
Within species |
37 |
1709.724 |
46.209 |
90% |
|
Note: d.f. = degree of
freedom; **P < 0.01
Fig. 2: Principal coordinates analysis (PCoA)
based on the matrix of Nei’s unbiased genetic
distance among 42 accessions of Viola
Based on 283 polymorphic alleles detected by 46 EST-SSR
markers, the genetic distances between section Viola and section Melanium were greater than
those among species of section Melanium (Table 5). PCoA partitioned 8.84 and
7.08% of the total variance to the first two axes, cumulating in 15.91% of the
total variation. PCoA clearly separated two
accessions of the section Viola from
those of section Melanium (Fig. 2), while
there was no obvious distinction between the accessions of V.×wittrockiana and those of the
other two species (V. tricolor and V. cornuta) of section Melanium. AMOVAs revealed
that 35% of the genetic diversity was presented between sections Melanium and Viola, whereas only 10% of
the genetic variation occurred among species of section Melanium
(Table 6).
Discussion
EST-SSR marker is one of most popular DNA
makers nowadays due to its codominant, highly informative, locus-specific and
adaptable to high-throughput genotyping, as well as gene tagging of interest traits and
higher levels of cross-species transferability. With the development of next-generation sequencing,
obtaining high-throughput information and development of EST-SSR markers on
large-scale through RNA-sequencing has become an efficient means. Using transcriptome sequencing, we obtained 6,863 specific EST-SSR primers for
pansies. Preliminary screening of seventy primers of them showed that 70% of these EST-SSR
primers successfully amplified DNA and 66% generated polymorphic alleles for
pansies (Table 2). The success of amplified primers in pansies was higher than that in Rosa roxburghii (Yan et al. 2015) and onion (Li et
al. 2015b), but lower than that in eggplant (Wei 2016) and Tagetes erecta (Zhang
et al. 2018). A possible reason for
some primers failing to produce amplicons is either an intron occurred within
the primer sequences interrupting amplification, or a large intron disrupted
PCR extension (Yu et al. 2004).
Because EST-SSR markers are developed in relatively conserved gene
sequences, this allowed to develop EST-SSR primers
that could amplify orthologous loci in multiple species. This study showed
EST-SSRs were not only highly conserved among the relative species in section Melanium, but also among more distantly related species in
section Viola with 81.6% of
transferability (Table 4). It is reported that SSRs were highly conserved in
barley and wheat (Holton et al. 2002;
Kantety et al.
2002; Yu et al. 2004).
Fig. 3: UPGMA Dendrogram of 42
pansies accessions and their related species based on EST-SSR markers (Note:
the labels at the right side indicate from the same parent or belonging to the
same specie s or section)
The occurrence of approximately 61%
of primers amplified at least one PCR fragment size larger than expected in
this study was also found in the study on hexaploid
wheat (Yu et al. 2004). The cause for
this phenomenon is not likely due to polymorphism of repeat length within the
SSRs, rather the result of insertion-deletion variability within the amplicon.
Some of EST-SSR primer pairs amplified more than one locus in pansies, which also happened
in hexaploid wheat (Yu et al. 2004). These multi-loci detecting markers appeared possibly owing to
sequence conservation in coding regions (Röder et al. 1998), polyploidy, and gene
duplication (Anderson et al. 1992).
The UPGMA of all
accessions showed the most breeding lines derived from the same parents were
firstly clustered together (Fig. 3), indicating the genetic relationships among
the accessions revealed based on the EST-SSRs was generally consistent with
their pedigrees. The PCoA (Fig. 2) and the UPGMA
(Fig. 3) clearly separated two accessions of the section Viola from those of section Melanium, and the result was further verified by the
results of AMOVA (Table 6). This observation was in concurrence with the
botanical classification. All of the above revealed the genetic relationships
based on the EST-SSR markers are reliable.
The PCoA based on the EST-SSR markers developed in this study
also revealed no obvious distinction among the accessions of V. ×wittrockiana and those of V. tricolor and V. cornuta (Fig. 2). This confirmed that V. tricolor and V. cornuta both participated in
the hybridization process of V.×wittrockiana (Clausen 1926).
Conclusion
Preliminary screening of 70 EST-SSR primers
obtained from transcriptome sequencing of V.×wittrockiana developed 49 EST-SSR markers for pansies and
showed high level of transferability by more than 80% from V.×wittrockiana to other
species of Viola genus. These markers generated a total
of 309 amplicons and 283 polymorphic alleles across 42 accessions of pansies
and their related species. Based on the polymorphic alleles detected, the genetic
relationships revealed that there was no obvious distinction between the
accessions of V.×wittrockiana and those of V.
tricolor and V. cornuta, confirming V. tricolor and V. cornuta both participating
in the hybridization process of V.×wittrockiana.
Acknowledgements
This work
was financially supported by the International Science and Technology Cooperation Research Programme of Henan Province (Grant No.182102410029) and Henan Institute of Science and
Technology Provincial and Ministerial Achievement Award Cultivation Project (Grant No. 2017CG02).
Author Contributions
XD planned and wrote the paper, HW and JM
performed the experiments, XZ statistically analyzed the data and made
illustrations, and HL reviewed the paper.
References
Anderson JA, Y
Ogihara, ME Sorrells, SD Tanksley
(1992). Development
of a chromosomal arm map for wheat based on RFLP markers. Theor Appl Genet 83:1035–1043
Clausen J (1926). Genetical and cytological investigations on Viola tricolor L. and V.
arvensis MURR. Hereditas 8:1–156
Cordeiro GM, R Casu, CL McIntyre, JM Manners, RJ Henry (2001). Microsatellite markers from sugarcane (Saccharum spp.) ESTs cross transferable to erianthus and sorghum. Plant
Sci 160:1115–1123
Culley TM,
SJ Sbita, A Wick (2007).
Population genetic effects of urban habitat
fragmentation in the perennial herb Viola
pubescens (Violaceae)
using ISSR markers. Ann Bot 100:91–100
Decroocq V, MG Fave, L Hagen, L Bordenave, S Decroocq
(2003). Development and transferability of apricot and grape
EST microsatellite markers across taxa. Theor Appl Genet 106:912–922
Du X, X Zhu, X Li,
J Mu, H Liu (2019a). Genetic diversity and structure in a germplasm collection
of pansies using SRAP markers. Intl J
Agric Biol 22:1244–1250
Du X, X Zhu, Y Yang,
Y Wang, P Arens, H Liu (2019b). De novo transcriptome analysis of Viola×wittrockiana exposed
to high temperature stress. PloS One 14;
Article e0222344
Holton TA, JT
Christopher, L McClure, N Harker, RJ Henry (2002). Identification and
mapping of polymorphic SSR markers from expressed gene sequences of barley and
wheat. Mol Breed 9:63–71
Jensen RJ (1989). NTSYS-PC numerical taxonomy and multivariate analysis system
version 1.40. Quat Rev Biol 64:250–252
Kantety RV,
ML Rota, DE Matthews, ME Sorrells (2002). Data mining for simple sequence
repeats in expressed sequence tags from barley, maize, rice, sorghum and wheat.
Plant Mol Biol 48:501–510
Ko MK,
J Yang, YH Jin, CH Lee, BJ Oh (1998). Genetic relationships of
Viola species evaluated by random amplified polymorphic DNA analysis. J Pomol Hort Sci 73:601–605
Li X, X Du, J Mu,
H Liu (2015a). Genetic diversity
analysis of 41 pansy germplasms based on RSAP markers. Acta Bot Bor-Occidentalia
Sin 35:1989–1997
Li
M, S Zhang, P Deng, X Hou, J Wang (2015b).
Analysis on SSR information in transcriptome of onion and the
polymorphism. Acta Hortic Sin 42:1103–1111
Liu
Y, S Li, Y Wang, P Liu, W Han (2020). De novo assembly of the seed
transcriptome and search for potential EST-SSR markers for an endangered,
economically important tree species: Elaeagnus
mollis Diels. J
For Res 31:759–767
Li
Y, J Liu, M Chen, Q Zhang, H Zhu, Q Wen (2018). SSR markers
excavation and germplasm analysis using the transcriptome information of Hibiscus esculentus.
Acta Hortic Sin
45:579–590
Liu Y, Y Geng,
M Song, P Zhang, J Hou, W Wang (2019). Genetic structure and diversity of glycyrrhiza populations based on
transcriptome SSR markers. Plant Mol Biol
Rep 37:401–412
Manee MM, BM Al-Shomran, MB Al-Fageeh (2020). Genome-wide
characterization of simple sequence repeats in Palmae genomes. Genes Genome 42:597–608
Nie G, L
Tang, Y Zhang, L Huang, X Ma, X Cao, L Pan, X Zhang, X Zhang (2017). Development of SSR markers based on transcriptome sequencing and
association analysis with drought tolerance in perennial grass Miscanthus from China. Front Plant Sci 8; Article 801
Peakall R, PE Smouse (2006). GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes 6:288–295
Peakall R, PE Smouse (2012). GenAlEx 6.5: Genetic
analysis in Excel. Population genetic software for teaching
and research-an update. Bioinformatics
28:2537–2539
Quardokus E (2000). PopGene. Science 288:458–459
Röder MS, V Korzun, K Wendehake,
J Plaschke, NH Tixier, P
Leroy, MW Ganal (1998). A microsatellite map of wheat.
Genetics 149:2007–2023
Schloss S, S Mitchell, G White, R Kukatla,
J Bowers, A Paterson, S Kresovich
(2002). Characterization of RFLP probe sequences for gene discovery and SSR
development in Sorghum bicolor (L.) Moench. Theor Appl Genet 105:912‒920
Varshney
RK, R Sigmund, A Bo¨rner, V Korzun, N Stein, ME Sorrells, P Langridge, A Graner (2005).
Interspecific transferability and comparative mapping of
barley EST-SSR markers in wheat, rye and rice. Plant Sci 168:195–202
Vemmos SN
(2015). Characterisation of genetic relationships in
pansy (Viola wittrockiana)
inbred lines using morphological traits and RAPD markers. J Pomol Hort Sci
80:529–536
Wang J, M Bao (2007).
Application of RAPD on analysis of genetic relationships
between inbred lines and prediction of heterosis in pansy (Viola wittrockiana). J Wuhan Bot Res 25:19–23
Wang
T, J Xu, X Zhang, L Zhao (2012). Genetic relationship of 43
cultivars of Viola tricolor and Viola cornuta
using SRAP marker. Sci Agric Sin
45:496–502
Wei
M (2016). Development and Application of
SSR Markers in Eggplant based on Transcriptome Sequencing. Chinese Academy
of Agricultural Sciences, Beijing, China
Wu J, C Cai, F Cheng (2014). Characterization and
development of EST-SSR markers in tree peony using transcriptome sequences.
Mol Breed 34:1853–1866
Xiao Y, L Zhou, W Xia, AS Mason, Y
Yang, Z Ma, M Peng (2014). Exploiting
transcriptome data for the development and characterization of gene-based SSR
markers related to cold tolerance in oil palm (Elaeis guineensis). BMC Plant Biol 14; Article 384
Yan
X, M Lu, H An (2015). Analysis on
SSR information in transcriptome and development of molecular markers in Rosa roxburghii.
Acta Hort Sin
42:341–349
Yockteng R,
HEJ Ballard, G Mansion, I Dajoz,
S Nadot (2003).
Relationships among pansies (Viola
section Melanium)
investigated using ITS and ISSR markers. Plant
Syst Evol 241:153–170
Yu J, TM Dake, S Singh, D Benscher, W Li,
B Gill, ME Sorrells (2004). Development and mapping of EST-derived simple
sequence repeat markers for hexaploid wheat. Genome 47:805–818
Zhang
H, R Cong, M Wang, A Dong, H Xin, M Yi, H Guo (2018). Development of SSR molecular markers based on transcriptome
sequencing of Tagetes erecta.
Acta Hort Sin 45:159–167
Zhang
Q, M Bao, X Lu, H Hu (2010). Research advances in breeding of pansy (Viola×wittrockiana). Chin Bull Bot 45:128–133